View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19087_low_16 (Length: 210)
Name: NF19087_low_16
Description: NF19087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19087_low_16 |
 | |
|
| [»] scaffold0282 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 9701385 - 9701552
Alignment:
| Q |
19 |
agaacaacctctaacacgcaacgagaaagctctcaacatcaatgagccactttattttattatgactgttgatggtttatgagactatgtatcgatcgat |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
9701385 |
agaacaacctctaacatgcaacgagaaagctctcaacatcaatgagccactttattttattatgactgttgatgatttatgagactatgt----atcgat |
9701480 |
T |
|
| Q |
119 |
gatgatatatgttgtatgatgacatagttgcttggagatttgttttgttattgatgaattgttgagatgatt |
190 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9701481 |
gatgatatatgttgtatgatgacatggttgcttggagatttgttttgttattgatgaattgttgagatgatt |
9701552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 13567624 - 13567791
Alignment:
| Q |
19 |
agaacaacctctaacacgcaacgagaaagctctcaacatcaatgagccactttattttattatgactgttgatggtttatgagactatgtatcgatcgat |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
13567624 |
agaacaacctctaacatgcaacgagaaagctctcaacatcaatgagccactttattttattatgactgttgatgatttatgagactatgt----atcgat |
13567719 |
T |
|
| Q |
119 |
gatgatatatgttgtatgatgacatagttgcttggagatttgttttgttattgatgaattgttgagatgatt |
190 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13567720 |
gatgatatatgttgtatgatgacatggttgcttggagatttgttttgttattgatgaattgttgagatgatt |
13567791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 73 - 186
Target Start/End: Complemental strand, 16673893 - 16673784
Alignment:
| Q |
73 |
ttttattatgactgttgatggtttatgagactatgtatcgatcgatgatgatatatgttgtatgatgacatagttgcttggagatttgttttgttattga |
172 |
Q |
| |
|
|||||||||||||||||| | ||| ||| ||||||||| ||| |||||| ||||| |||||||||||| | | ||||||||||| |||| ||||||| |
|
|
| T |
16673893 |
ttttattatgactgttgaggatttttgaaactatgtattgat----gatgatgtatgtagtatgatgacatggctacttggagatttatttttttattga |
16673798 |
T |
|
| Q |
173 |
tgaattgttgagat |
186 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
16673797 |
tgaattgttgagat |
16673784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 117 - 190
Target Start/End: Complemental strand, 23601004 - 23600931
Alignment:
| Q |
117 |
atgatgatatatgttgtatgatgacatagttgcttggagatttgttttgttattgatgaattgttgagatgatt |
190 |
Q |
| |
|
|||||||||||||| |||||||||||| | |||||||| || |||| |||||||||||||||||| |||||| |
|
|
| T |
23601004 |
atgatgatatatgtagtatgatgacatgactacttggagacttattttattattgatgaattgttgaaatgatt |
23600931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0282 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0282
Description:
Target: scaffold0282; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 73 - 190
Target Start/End: Original strand, 21340 - 21452
Alignment:
| Q |
73 |
ttttattatgactgttgatggtttatgagactatgtatcgatcgatgatgatatatgttgtatgatgacatagttgcttggagatttgttttgttattga |
172 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| | ||||||||||||||| ||||| |||| | | | ||||||||||| |||| ||||||| |
|
|
| T |
21340 |
ttttattatgactgttg-tggattatgagactatgt----gttgatgatgatatatgtagtatgttgacctggctacttggagatttattttattattga |
21434 |
T |
|
| Q |
173 |
tgaattgttgagatgatt |
190 |
Q |
| |
|
||| | ||||||||||| |
|
|
| T |
21435 |
tgatctattgagatgatt |
21452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University