View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19088_high_14 (Length: 270)

Name: NF19088_high_14
Description: NF19088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19088_high_14
NF19088_high_14
[»] chr4 (1 HSPs)
chr4 (26-141)||(50831010-50831125)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 26 - 141
Target Start/End: Complemental strand, 50831125 - 50831010
Alignment:
26 tgggcttttagaaactgcatgacattaccttgaattacagtgttcttaatatttcagtagtaccgttctaagtgtcgaaggctatgtagccaagtcaaag 125  Q
    ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| | ||||| |||| ||||||||| |||||||| ||||||||||||    
50831125 tgggcttttagaaactgcatgacattaccttcaattacagtgtccttaatatttcggaagtacggttcaaagtgtcgatggctatgtcgccaagtcaaag 50831026  T
126 acggaggggagtgctt 141  Q
    ||  ||||||||||||    
50831025 accaaggggagtgctt 50831010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University