View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19088_high_17 (Length: 249)
Name: NF19088_high_17
Description: NF19088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19088_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 27053628 - 27053406
Alignment:
| Q |
18 |
ttactaaccctttcaaagattacgccaaaagaggtatttcattcggcatctacactaaatcttcttcaactaactccgttaccagtttggtggttgaacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27053628 |
ttactaaccctttcaaagattacgccaaaagaggtatttcattcggcatctacactaaatcttcttcaactaactccgttaccagtttggtggttgaacc |
27053529 |
T |
 |
| Q |
118 |
aggtaagtttttccgcgaaacgatgttgaaggaagggactgttatgcctatgccagatataagggataagttaccacctaggtcgtttttgccccgttcc |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27053528 |
aggtaagtttttccgcgaaaggatgttgaaggaagggactgttatgcctatgccagatacaagggataagttaccacctaggtcgtttttgccacgttcc |
27053429 |
T |
 |
| Q |
218 |
attttgatcaaattgccctttgc |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
27053428 |
attttgatcaaattgccctttgc |
27053406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 108 - 240
Target Start/End: Complemental strand, 27065980 - 27065848
Alignment:
| Q |
108 |
tggttgaaccaggtaagtttttccgcgaaacgatgttgaaggaagggactgttatgcctatgccagatataagggataagttaccacctaggtcgttttt |
207 |
Q |
| |
|
||||| |||| |||||||||||||| || | |||||||||||||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
27065980 |
tggttcaacctggtaagtttttccgggagaagatgttgaaggaagggacagttatgcctatgccagatataagggataaattaccgccaaggtcgttttt |
27065881 |
T |
 |
| Q |
208 |
gccccgttccattttgatcaaattgccctttgc |
240 |
Q |
| |
|
||| ||||||||||||| ||||||||| ||||| |
|
|
| T |
27065880 |
gcctcgttccattttgaccaaattgccatttgc |
27065848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 109 - 240
Target Start/End: Complemental strand, 27079696 - 27079565
Alignment:
| Q |
109 |
ggttgaaccaggtaagtttttccgcgaaacgatgttgaaggaagggactgttatgcctatgccagatataagggataagttaccacctaggtcgtttttg |
208 |
Q |
| |
|
|||| |||| |||||||||||||| |||| ||||||||| ||||| |||||||||||||| ||||| | |||||| ||||| || ||||||||||| |
|
|
| T |
27079696 |
ggttcaacctggtaagtttttccgagaaaagatgttgaaacaaggggtggttatgcctatgccggatattaaggataaattaccgccaaggtcgttttta |
27079597 |
T |
 |
| Q |
209 |
ccccgttccattttgatcaaattgccctttgc |
240 |
Q |
| |
|
|| ||| ||||||||| |||||| |||||||| |
|
|
| T |
27079596 |
ccacgtaccattttgaccaaattaccctttgc |
27079565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University