View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19088_high_18 (Length: 214)
Name: NF19088_high_18
Description: NF19088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19088_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 195
Target Start/End: Complemental strand, 5062262 - 5062080
Alignment:
| Q |
13 |
gaagaatattgtaagtttggaaaattgacaacttaattttgtcactagttaagagtagcatgtcagtgctatcaagcctagtacatgttttaataactat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5062262 |
gaagaatattgtaagtttggaaaattgacaacttaattttgtcactagttaagagtagcatgtcagtgctatcaagcctagtacatgttttagtaactat |
5062163 |
T |
 |
| Q |
113 |
tccttgtctatggaccagactaatcaaattttggtcaatgctagagcctagagtgtggcactttcattaagtttccctccttt |
195 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5062162 |
tccatgtctatggaccagactaatcaaattttggtcaatgctagagcctagagtgtggcactttcattaagtttccctccttt |
5062080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University