View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19088_low_8 (Length: 351)
Name: NF19088_low_8
Description: NF19088
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19088_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 5e-41; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 218 - 332
Target Start/End: Complemental strand, 40338788 - 40338682
Alignment:
| Q |
218 |
caattgtttggaaggaatcttcttataaggacagaattgtcacgacattaatttgtcatccaggacagaattttagattttaaaattggttggtacatat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40338788 |
caattgtttggaaggaatcttcttataaggacagaattgtcacgacattaatttgtcatccaggac--------agattttaaaattggttggtacatat |
40338697 |
T |
|
| Q |
318 |
tgtcgtatactatag |
332 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40338696 |
tgtcgtatactatag |
40338682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 40338992 - 40338897
Alignment:
| Q |
1 |
cttgagtatccacgcatgttagatttgaacgtctgatgcttttctcagggatgctcttcatgttaaaatatgcggtgttacctacatgttgacata |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |||||| |
|
|
| T |
40338992 |
cttgagtatccacgcatgttagatttgaacgtctgatgcttttctcagggatgctcttcaagttaaaatgtgcggtgttacctacatgtagacata |
40338897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 143
Target Start/End: Complemental strand, 40338897 - 40338863
Alignment:
| Q |
109 |
aaatatcattcagtactcaccttagacatgttact |
143 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40338897 |
aaatatcattcggtactcaccttagacatgttact |
40338863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University