View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19089_high_16 (Length: 206)
Name: NF19089_high_16
Description: NF19089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19089_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 8 - 189
Target Start/End: Complemental strand, 29672762 - 29672581
Alignment:
| Q |
8 |
acacccactaccaaaaacctccgacccacgtgtccaaattgccggtaacttcgccccagtaccggaacacccggtaacccaatctcttccaattaccggc |
107 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672762 |
acacccactacccaaaacctccgacccacgtgttcaaattgccggtaacttcgccccagtaccggaacacccggtaacccaatctcttccaattaccggc |
29672663 |
T |
|
| Q |
108 |
aaaatcccaaccaacattgacggtgtttacctccgtaacggcgccaatccactttacgagccagtagccggtcaccacttct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29672662 |
aaaatcccaaccaacattgacggtgtttacctccgtaacggcgccaatccactttacgagccagtagccggtcaccacttct |
29672581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University