View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19089_low_15 (Length: 235)
Name: NF19089_low_15
Description: NF19089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19089_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 4 - 174
Target Start/End: Complemental strand, 8177869 - 8177699
Alignment:
| Q |
4 |
cattgatattgaagttgaaatgagtattttaagtactatagctagttttttaggatttggaattggaacttcacttggattgctgataggatactttatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8177869 |
cattgatattgaagttgaaatgagtattttaagtactatagctagttttttaggatttggaattggaacttcacttggattgctgataggatactttatg |
8177770 |
T |
 |
| Q |
104 |
tttatatactttgaatcaatagatgtcaaggtttgtttctatttctcactttttctctaaaatgattctct |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8177769 |
tttatatactttgaatcaatagatgtcaaggtttgtttctatttctcactttttctctaaaatgattctct |
8177699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University