View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19089_low_17 (Length: 221)
Name: NF19089_low_17
Description: NF19089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19089_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 35557654 - 35557461
Alignment:
| Q |
19 |
atgctacaactaaaatatcatgtatgcttaagt-ataatgtgtcactaactcactgttgttttgacaaatgctatactctaaagcttcaacaaaattaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
35557654 |
atgctacaactaaaatatcatgtatgcttaagttataatgtgtcagtaactcactgttgttttgacgaatgttatactctaaagcttcaacaaaattaca |
35557555 |
T |
|
| Q |
118 |
gtgttgccgtaatttcatcaaaatcaccttgatttccacatgcaccgaaacacaggtagattttatttgcaacttctctttttatccacaggtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35557554 |
atgttgccgtaatttcatcaaaatcaccttgatttccacatgcactgaaacacaggtagattttatttgcaacttctctttttatccactggtt |
35557461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University