View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19089_low_18 (Length: 206)

Name: NF19089_low_18
Description: NF19089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19089_low_18
NF19089_low_18
[»] chr2 (1 HSPs)
chr2 (8-189)||(29672581-29672762)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 8 - 189
Target Start/End: Complemental strand, 29672762 - 29672581
Alignment:
8 acacccactaccaaaaacctccgacccacgtgtccaaattgccggtaacttcgccccagtaccggaacacccggtaacccaatctcttccaattaccggc 107  Q
    |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29672762 acacccactacccaaaacctccgacccacgtgttcaaattgccggtaacttcgccccagtaccggaacacccggtaacccaatctcttccaattaccggc 29672663  T
108 aaaatcccaaccaacattgacggtgtttacctccgtaacggcgccaatccactttacgagccagtagccggtcaccacttct 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29672662 aaaatcccaaccaacattgacggtgtttacctccgtaacggcgccaatccactttacgagccagtagccggtcaccacttct 29672581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University