View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1908_high_3 (Length: 218)
Name: NF1908_high_3
Description: NF1908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1908_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 30666605 - 30666809
Alignment:
| Q |
1 |
cttatggttcgttctttctaccaaactaactagtattaatgttaattcaattttcaattttttagggtctttttgtgttccacatcaaatgcttctatca |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30666605 |
cttatggttcgttctttctactaaactaactagtattaatgttaattcaattttcaattttttagggtctttttgtgttcaacatcaaatgcttctatca |
30666704 |
T |
 |
| Q |
101 |
tttgcacttatgttaacaacagtttgtactttgatgcagtttttggttacgaaccacattcagttctgccaattggagttgttgcgctagccgacagcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30666705 |
tttgcacttatgttaacaacagtttgtactttgatgcagtttttggttacgaaccacattcagttctgccaattggagttgttgcgctagccgacagcac |
30666804 |
T |
 |
| Q |
201 |
aggtt |
205 |
Q |
| |
|
||||| |
|
|
| T |
30666805 |
aggtt |
30666809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 134 - 205
Target Start/End: Complemental strand, 10112972 - 10112901
Alignment:
| Q |
134 |
atgcagtttttggttacgaaccacattcagttctgccaattggagttgttgcgctagccgacagcacaggtt |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||| ||| |||| ||||| |||| |||||||| |
|
|
| T |
10112972 |
atgcagtttttggttatgaaccacattcagttttgccaattggcgttattgcactagctgacaacacaggtt |
10112901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University