View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1908_low_5 (Length: 218)

Name: NF1908_low_5
Description: NF1908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1908_low_5
NF1908_low_5
[»] chr8 (1 HSPs)
chr8 (1-205)||(30666605-30666809)
[»] chr5 (1 HSPs)
chr5 (134-205)||(10112901-10112972)


Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 30666605 - 30666809
Alignment:
1 cttatggttcgttctttctaccaaactaactagtattaatgttaattcaattttcaattttttagggtctttttgtgttccacatcaaatgcttctatca 100  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
30666605 cttatggttcgttctttctactaaactaactagtattaatgttaattcaattttcaattttttagggtctttttgtgttcaacatcaaatgcttctatca 30666704  T
101 tttgcacttatgttaacaacagtttgtactttgatgcagtttttggttacgaaccacattcagttctgccaattggagttgttgcgctagccgacagcac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30666705 tttgcacttatgttaacaacagtttgtactttgatgcagtttttggttacgaaccacattcagttctgccaattggagttgttgcgctagccgacagcac 30666804  T
201 aggtt 205  Q
    |||||    
30666805 aggtt 30666809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 134 - 205
Target Start/End: Complemental strand, 10112972 - 10112901
Alignment:
134 atgcagtttttggttacgaaccacattcagttctgccaattggagttgttgcgctagccgacagcacaggtt 205  Q
    |||||||||||||||| ||||||||||||||| |||||||||| ||| |||| ||||| |||| ||||||||    
10112972 atgcagtttttggttatgaaccacattcagttttgccaattggcgttattgcactagctgacaacacaggtt 10112901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University