View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19091_high_9 (Length: 202)
Name: NF19091_high_9
Description: NF19091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19091_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 182
Target Start/End: Original strand, 37784543 - 37784707
Alignment:
| Q |
18 |
gtcccaaattgaacggttatagaggcttcggcgttgttctacctttatcaaaatttgaaatgtgctatttgaacaaaattatacgctcaagaaatttatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37784543 |
gtcccaaattgaacggttatagaggcttcggcgttgttctacctttatcaaaatttgaaatgtgctatttgaacaaaattgcacgctcaagaaatttatt |
37784642 |
T |
 |
| Q |
118 |
aaacaggaaattatgttcattaaaatatgtgaattatcatgaaaataaaataggaattttatgtc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37784643 |
aaacaggaaattatgttcattaaaatatgtgaattatcatgaaaataaaataggaattttatgtc |
37784707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University