View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19092_high_12 (Length: 289)
Name: NF19092_high_12
Description: NF19092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19092_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 36 - 279
Target Start/End: Original strand, 28463339 - 28463582
Alignment:
| Q |
36 |
ggaatataatgagaaaggttgatcaaatccactgcagtcttcattgcatgctctctttaaccactgacattaccaacttccatgtggagctaaattagta |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
28463339 |
ggaatataatgagaaaggttgatcaaatccactgcagtcttcattgcatgctctctttaaccactgacattaccaacttccatttggagcgaaattagta |
28463438 |
T |
 |
| Q |
136 |
aatttcacaacaacnnnnnnnnntctcaattattaggcaaggaactgagcaacaataaggcttttaaatcatcatacaatttcttataaacagttgtctg |
235 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||| |
|
|
| T |
28463439 |
aatttcacaacaacaaaaaaaaatctcaattattaggcaaggaactgagcaacaataaggcttttaactcatcatacaatttcttatcagcagttgtctg |
28463538 |
T |
 |
| Q |
236 |
ctgattcccattggtcagaaacacactaatatgctttgcctttg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28463539 |
ctgattcccattggtcagaaacacactaatatgctttgcctttg |
28463582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University