View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19092_high_17 (Length: 251)
Name: NF19092_high_17
Description: NF19092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19092_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 1216425 - 1216207
Alignment:
| Q |
14 |
atgaatgcatacgtacataagtacatgtttatataagcatatgcttctttaagaacgcataacatattagtatttttgtactaccttaaatgaaatatta |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
1216425 |
atgaatgcatacgtacgtaagtacatgtttatataagcatatgcttctttaagaacgcataacatattagtatttttgtactaccttaaacgaaatgtta |
1216326 |
T |
|
| Q |
114 |
gaaggcgaggtttcttgttgaacactccctcctcaaattgtactttgcgttttaaatcttttggatctacttccatatctgaagcgacaaaacaaaacat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1216325 |
gaaggcgaggtttcttgttgaacactccctcctcaaattgtactctgcgttttaaatcttttggatctacttccatatctgaagcgacaaaacaaaacat |
1216226 |
T |
|
| Q |
214 |
taggttttcttgttgaacc |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1216225 |
taggttttcttgttgaacc |
1216207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University