View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19092_high_4 (Length: 551)
Name: NF19092_high_4
Description: NF19092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19092_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 72 - 329
Target Start/End: Original strand, 3159244 - 3159501
Alignment:
| Q |
72 |
catgaaagccgtagaaattgttgttgagcaaggttggaggaacctttggatagaatctgattctcggttagtggtgcttgcttttaagaagaaatctttg |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3159244 |
catgaaagccgtagaaattgttgttgagcaaggttggaggaacctttggatagaatctgattctcggttagtggtgcttgcttttaagaagaaatctttg |
3159343 |
T |
 |
| Q |
172 |
gtgccttggaaaacaagcagccactagaaaaaatgtttggatctttgtaagaatatgaatgtttttatttttaatgtttataaggaagacaatagttgtg |
271 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3159344 |
gtgccttggtaaacaagcagccactagaaaaaatgtttggatctttgtaagaatatgaatgtttttatttttaatgtttataaggaagacaatagttctg |
3159443 |
T |
 |
| Q |
272 |
caaaatgatctggctaatctaggtctaaactatagataactatactttttggaacact |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3159444 |
caaaatgatctggctaatctaggtctaaactatagataattatactttttggaacact |
3159501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 447 - 481
Target Start/End: Original strand, 3159597 - 3159631
Alignment:
| Q |
447 |
gtgaggcaattcttcaattgtccacttttgattag |
481 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3159597 |
gtgaggcaattcttcaattgtccacttttgattag |
3159631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 352 - 381
Target Start/End: Original strand, 3159499 - 3159528
Alignment:
| Q |
352 |
actttggtaggaacaaacttggtataccaa |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3159499 |
actttggtaggaacaaacttggtataccaa |
3159528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University