View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19092_low_29 (Length: 216)

Name: NF19092_low_29
Description: NF19092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19092_low_29
NF19092_low_29
[»] chr2 (1 HSPs)
chr2 (1-209)||(9713833-9714041)
[»] chr8 (1 HSPs)
chr8 (158-205)||(16952563-16952611)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 9714041 - 9713833
Alignment:
1 agttcttaggcggaccgcttcataagcagtcgaccatagatcagtcattaaaattattagaaatttcaatgatcatcgacgatactatattagaaataaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||    
9714041 agttcttaggcggaccgcttcataagcagtcgaccatagatcagtcattaaaattattagaaatttcaacgaccatcgacgatactacattagaaataaa 9713942  T
101 tgagctatttacatattagtacggttaatttcacgacccttatatttacagttaatttggtgacttatagatatcggttcaatacgaactacatatttat 200  Q
    |||| ||| ||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||    
9713941 tgagttatctacatatcagtacggttaattttacgacccttatatttatagttaatttggtgacttatagatgtcggttcaatacgaactacatatttat 9713842  T
201 tttcctttg 209  Q
    |||||||||    
9713841 tttcctttg 9713833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 16952611 - 16952563
Alignment:
158 tggtgactt-atagatatcggttcaatacgaactacatatttattttcc 205  Q
    ||||||||| || ||||||||||||||| || |||||||||||||||||    
16952611 tggtgacttgattgatatcggttcaataggagctacatatttattttcc 16952563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University