View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19093_high_24 (Length: 225)
Name: NF19093_high_24
Description: NF19093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19093_high_24 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 42005476 - 42005699
Alignment:
| Q |
1 |
gttgatggaaccaaagcaatgatcacaagagcaacaataataaaaactttgtgagagaaagccattttctttttatattttcaatgattag-tttggcga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42005476 |
gttgatggaaccaaagcaatgatcacaagagcaacaataataaaaactttgtgagaggaagccattttctttttatattttcaatgattagttttggcga |
42005575 |
T |
 |
| Q |
100 |
aaacatgcttataaggtcnnnnnnnnnnnncactcctatagctaggggtatttgatttgtaacgattagatgaaaagatgaagggtgtaaatataattgt |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42005576 |
aaacatgcttataaggtc--tatatttatacactcctatagctaggggtatttaatttgtaacgattggatgaaaagatgaagggtgtaaatataattgt |
42005673 |
T |
 |
| Q |
200 |
gcaattgtaacatataagataagact |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42005674 |
gcaattgtaacatataagataagact |
42005699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University