View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19093_low_19 (Length: 294)
Name: NF19093_low_19
Description: NF19093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19093_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 22 - 281
Target Start/End: Original strand, 11119363 - 11119628
Alignment:
| Q |
22 |
agaaatcttctgaattggatcttgctagtgtggcctcagaatcaatggagggggatatggttagttcaatctaaatgaatgtgggttactttagttgaaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11119363 |
agaaatcttctgaattggatcttgctagtgtgacctcagaatcaatggagggggatatggttagttcaatctaaatgaatgtgggttactttagttgaaa |
11119462 |
T |
|
| Q |
122 |
tgcatgtggtgattggaattcactaataaagaaaagtgctagctaggcacatctgtgccttgatgtgtatgttatgtgctttatgtgtgcaagataa-cc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11119463 |
tgcatgtggtgattggaattcactaataaagaaaagtgctagctaggcacatctgtgccttgatgtgtatgttatgtgctttatgtgtgcaagataatct |
11119562 |
T |
|
| Q |
221 |
nnnnnnnnnctaagtaattttc-----attatagtatatcctctctttccgtcacaagttatgtct |
281 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11119563 |
tttttttttctaagtaattttcattatattatagtatatcctctctttccgtcacaagttatgtct |
11119628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 22 - 178
Target Start/End: Original strand, 11111592 - 11111747
Alignment:
| Q |
22 |
agaaatcttctgaattggatcttgctagtgtggcctc---agaatcaatggagggggatatggttagttcaatctaaatgaatgtgggttactttagttg |
118 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11111592 |
agaaatcttctgaattggatcttggcattgtggcctctgcagaatcaatggaaggggatatggttagttcaatctaaatgaatgtgggttactttagatg |
11111691 |
T |
|
| Q |
119 |
aaatgcatgtggtgattggaattcactaataaagaaaagtgctagctaggcacatctgtg |
178 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||| |||| |||||| |||| |
|
|
| T |
11111692 |
aa----atgtggtgattggaattcactaataaagagaagtgctggctaagcacatttgtg |
11111747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University