View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19093_low_30 (Length: 216)
Name: NF19093_low_30
Description: NF19093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19093_low_30 |
 |  |
|
| [»] scaffold0352 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 19769062 - 19768983
Alignment:
| Q |
19 |
gaacaaaatctctgaatgcgaagacgaaatctttctgacggcgaagatggagaaggttataaccagagaaggatttgcga |
98 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19769062 |
gaacaaaatctctgaatgcgaagatgaaatctttttgacggcgaagacggagaaggttataaccagagaaggatttgcga |
19768983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 199
Target Start/End: Original strand, 16628 - 16672
Alignment:
| Q |
156 |
aagtcatgggaatgtatgtgcgttggaatagt-aaaatatcacac |
199 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| |||||||||||| |
|
|
| T |
16628 |
aagtcatgagaatgtatgtgcattggaatagtaaaaatatcacac |
16672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University