View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19094_high_19 (Length: 208)
Name: NF19094_high_19
Description: NF19094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19094_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 22 - 192
Target Start/End: Complemental strand, 31628144 - 31627974
Alignment:
| Q |
22 |
gaagaatctgtagcctgattaaattatttgtcgttggcaaacgatttcgaagaagacaccaagcaaaaatggtgacttttagaggagactctttatgcca |
121 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31628144 |
gaagaatttgtagcctggttaaattatttgtcgttggcaaacgatttcaaagaagacaccaagcaaaaatggtgacttttagaggagactctttatgcca |
31628045 |
T |
 |
| Q |
122 |
gattatgtttgtatatcagttgtaaggctgtgttccatcgtgaacaggtggttgtaagcactacaagtatt |
192 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31628044 |
tattatgtttgtatatcagttgtaaggttgtgttccatcgtgaacagatggttgtaagcactacaagtatt |
31627974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University