View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19094_high_19 (Length: 208)

Name: NF19094_high_19
Description: NF19094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19094_high_19
NF19094_high_19
[»] chr5 (1 HSPs)
chr5 (22-192)||(31627974-31628144)


Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 22 - 192
Target Start/End: Complemental strand, 31628144 - 31627974
Alignment:
22 gaagaatctgtagcctgattaaattatttgtcgttggcaaacgatttcgaagaagacaccaagcaaaaatggtgacttttagaggagactctttatgcca 121  Q
    ||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
31628144 gaagaatttgtagcctggttaaattatttgtcgttggcaaacgatttcaaagaagacaccaagcaaaaatggtgacttttagaggagactctttatgcca 31628045  T
122 gattatgtttgtatatcagttgtaaggctgtgttccatcgtgaacaggtggttgtaagcactacaagtatt 192  Q
     |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||    
31628044 tattatgtttgtatatcagttgtaaggttgtgttccatcgtgaacagatggttgtaagcactacaagtatt 31627974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University