View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19094_low_18 (Length: 228)
Name: NF19094_low_18
Description: NF19094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19094_low_18 |
 | |
|
| [»] scaffold0005 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0005 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 232094 - 232286
Alignment:
| Q |
19 |
attgtacttgcaacaatttgcggtatcgagtccaagtatggttggtattatgattcatgcaccaaatgtgcagcaagggttaagattgtggctggaaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
232094 |
attgtacttgcaacaatttgcggtatcgagtccaagtatggttggtattatgattcatgcaccaaatgtgcggcaagggttaagattgtggctggaaaaa |
232193 |
T |
|
| Q |
119 |
tgtattgttcgatatgtaagctgggaaggaatgttgtgccaaggccatctaactaatgatttttaaattttcttaattgcttcttcggatatt |
211 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
232194 |
tgtattgttcgagatgtaagcagggaaggaatgttgtgcccaggtcagctaactaatgatttttaaattttcttaattgcttctttggatatt |
232286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 14585281 - 14585089
Alignment:
| Q |
19 |
attgtacttgcaacaatttgcggtatcgagtccaagtatggttggtattatgattcatgcaccaaatgtgcagcaagggttaagattgtggctggaaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14585281 |
attgtacttgcaacaatttgcggtatcgagtccaagtatggttggtattatgattcatgcaccaaatgtgcggcaagggttaagattgtggctggaaaaa |
14585182 |
T |
|
| Q |
119 |
tgtattgttcgatatgtaagctgggaaggaatgttgtgccaaggccatctaactaatgatttttaaattttcttaattgcttcttcggatatt |
211 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14585181 |
tgtattgttcgagatgtaagcagggaaggaatgttgtgcccaggtcagctaactaatgatttttaaattttcttaattgcttctttggatatt |
14585089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 55 - 113
Target Start/End: Original strand, 11217813 - 11217871
Alignment:
| Q |
55 |
tatggttggtattatgattcatgcaccaaatgtgcagcaagggttaagattgtggctgg |
113 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | |||| ||| |||||| ||||| |
|
|
| T |
11217813 |
tatggttggtattatgatgcatgcaccaaatgtgctggaaggattacgattgttgctgg |
11217871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 55 - 113
Target Start/End: Original strand, 11228320 - 11228378
Alignment:
| Q |
55 |
tatggttggtattatgattcatgcaccaaatgtgcagcaagggttaagattgtggctgg |
113 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | |||| ||| |||||| ||||| |
|
|
| T |
11228320 |
tatggttggtattatgatgcatgcaccaaatgtgctggaaggattacgattgttgctgg |
11228378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University