View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19095_high_20 (Length: 237)
Name: NF19095_high_20
Description: NF19095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19095_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 47648851 - 47649053
Alignment:
| Q |
20 |
atagaataagtttgggtagatgctaaagtcatcaattatatgttaatagaccctgagatatgggaaaattttggactactcctaacctaagggaataata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47648851 |
atagaataagtttgggtagatgctaaagtcatcaattatatgttaatagaccctgagatatgggaaaattttggactactcctaacctaaggg-ataata |
47648949 |
T |
 |
| Q |
120 |
tgtagaaacggaggttcgtggaagtctatgacgaatgtaaca-ttgtttttgtctactaattatcctaagtcaattatttaattttgtttttatcctgat |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47648950 |
tgtagaaacggagtttcgtggaagtctatgacgaatgtaacatttttttttgtctactaattatcctaagtcaattatttaattttgtttttatcctgat |
47649049 |
T |
 |
| Q |
219 |
ttct |
222 |
Q |
| |
|
|||| |
|
|
| T |
47649050 |
ttct |
47649053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University