View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19095_low_14 (Length: 323)
Name: NF19095_low_14
Description: NF19095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19095_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 11 - 176
Target Start/End: Original strand, 16757995 - 16758162
Alignment:
| Q |
11 |
cacagacaggaaaatctttagatgatgaagaagccttggagcaaccgattcccaaggttgagagatatggtctaacaaatagtatctagaactttgcatt |
110 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16757995 |
cacacacaagaaaatctttagatgatgaagaagccttggagcaaccgattcccaaggttgagagatatggtctaacaaatagtatctagaactttgcatt |
16758094 |
T |
 |
| Q |
111 |
actctttatctgttac--nnnnnnnnnnnngtataatttggttgaattatgcaccacatcattgtgca |
176 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16758095 |
actctttatctgttactttttttttttttggtataatttggttgaattatgcaccacatcattgtgca |
16758162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 220 - 307
Target Start/End: Original strand, 16758207 - 16758294
Alignment:
| Q |
220 |
atattgttgttatcacttgagatcatgtgactaattgatgagacgcatttatctgttttgatttgcaatactctaagcatgaaaaaag |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16758207 |
atattgttgttatcacttgagatcatgtgactaattgatgagacgcatttatctgttttgatttgcaatactctaagcaggaaaaaag |
16758294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University