View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19095_low_15 (Length: 313)
Name: NF19095_low_15
Description: NF19095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19095_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 145 - 302
Target Start/End: Complemental strand, 23034525 - 23034369
Alignment:
| Q |
145 |
gaaatctagcatccacgtgacatttcaatctttcgggatctggataaagccacatgttttccatacaaccgtttgcacataaccaacaaccaccacaaca |
244 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23034525 |
gaaatctagcatccatgttacatttcaatctttcgggatctggataaagccacatgttttcca-acaaccgttggcacataaccaacaaccaccacaaca |
23034427 |
T |
 |
| Q |
245 |
gtctctccaaactagattctgaaccttcggctgcactctcactttcatgttccttcat |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
23034426 |
gtctctccaaactagattctgaaccttcggttgcactctcactttcatgttgcttcat |
23034369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 17 - 117
Target Start/End: Complemental strand, 23034713 - 23034613
Alignment:
| Q |
17 |
gaatttaaattacttataatctcaggtatgataacatgtaactcagaaatacaatctgctctagaacaatagcatctgccagtatcttcgagtcaatttt |
116 |
Q |
| |
|
||||||||| ||||||||||||||| | ||||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23034713 |
gaatttaaaatacttataatctcagctgtgataacgtgtaattcagaaatacaatctgctctagaacaatagcatccgccagtatcttcgagtcaatttt |
23034614 |
T |
 |
| Q |
117 |
g |
117 |
Q |
| |
|
| |
|
|
| T |
23034613 |
g |
23034613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University