View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19095_low_19 (Length: 252)
Name: NF19095_low_19
Description: NF19095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19095_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 10121478 - 10121702
Alignment:
| Q |
18 |
cagaagaagggtcagacaaaaaagtctctttcagatctgcaagagacagctctggtcatgggagccatacagcttccacagcagcaggacgatacgtctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10121478 |
cagaagaagggtcagacaaaaaagtctctttcagatctgcaagagacagctctggtcatgggagccatacagcttccacagcagcaggacgatacgtctc |
10121577 |
T |
|
| Q |
118 |
aaacatgaattataatgggttagcagcaggaaatgctaggggaggtgcaccaatggctaggatttctgtttacaaaacttgttgggattcaggttgctat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10121578 |
aaacatgaattataatgggttagcagcaggaaatgctaggggaggtgcaccaatggctaggatttctgtttacaaaacttgttgggattcaggttgctat |
10121677 |
T |
|
| Q |
218 |
gatgtggacttgttagctgcctttg |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10121678 |
gatgtggacttgttagctgcctttg |
10121702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 37 - 242
Target Start/End: Complemental strand, 30628580 - 30628375
Alignment:
| Q |
37 |
aaaagtctctttcagatctgcaagagacagctctggtcatgggagccatacagcttccacagcagcaggacgatacgtctcaaacatgaattataatggg |
136 |
Q |
| |
|
|||| |||| |||||||| || || |||||| | |||||||| |||||||||||||| | ||| ||||| |||| || ||||||||||||||| || |
|
|
| T |
30628580 |
aaaaatctcattcagatcagctagggacagcacaggtcatggtagccatacagcttcaatagctgcagggagatatgtacaaaacatgaattataaagga |
30628481 |
T |
|
| Q |
137 |
ttagcagcaggaaatgctaggggaggtgcaccaatggctaggatttctgtttacaaaacttgttgggattcaggttgctatgatgtggacttgttagctg |
236 |
Q |
| |
|
||||| ||| ||| |||||||||||||| |||||||| ||| |||| |||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30628480 |
ctagcaagtggaggtgcaaggggaggtgcacctatggctagaattgctgtgtacaaaacatgttgggattcaggttgctatgatgtggacttgctagctg |
30628381 |
T |
|
| Q |
237 |
cctttg |
242 |
Q |
| |
|
| |||| |
|
|
| T |
30628380 |
catttg |
30628375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University