View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19095_low_24 (Length: 234)
Name: NF19095_low_24
Description: NF19095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19095_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 7564766 - 7564568
Alignment:
| Q |
19 |
tcttggactaaattgttcagtgttccattcacagaattcattgattatttctatgcacgtctgctttttatttatgaggaggatgaccaagtgttgcttg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||| ||| |||||||| | |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7564766 |
tcttggactaaattgttcagtgttccattcaaagaattcagtgataattgctatgcacctgtgctttttatctatgaggaggatgaccaagtgttgcttg |
7564667 |
T |
 |
| Q |
119 |
acttttgtggtaagttatatgtttacaattataagaatggtaccgtaaagatttcggggattcaaaatgtcgcttttaccgatttctcgtctaatgtct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
7564666 |
acttttgtggtaagttatatgtttacaattataagaatggtaccgtaaagatttcggggattcaaaatctcgcttttaccgatttctcctctaatgtct |
7564568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University