View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19097_high_70 (Length: 252)
Name: NF19097_high_70
Description: NF19097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19097_high_70 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 40513675 - 40513459
Alignment:
| Q |
15 |
cacagattaaaaatataccatgcaagttaagtatgcaaactttgaattcatgtgaaagagcggaggggcatgaggaattgcagaattaatatagaaaaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40513675 |
cacagattaaaaatataccatgcaagttaagtatgcaaactttgaattcatgtgaaagagcggaggggcatgaggaattgcagaattaatatagaaaaga |
40513576 |
T |
|
| Q |
115 |
ttaattttttaaccttaccattacactcttatcaacaggcatatcatcccagttacgctgaacttgcaaaccacttccattgtggtgcatgttcatcatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40513575 |
ttaattttttaaccttaccattacactcttatcaacaggcatatcatcccagttacgctgaacttgcaaaccacttccattgtggtgcatgttcatcatt |
40513476 |
T |
|
| Q |
215 |
tgaacatcagagttaga |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40513475 |
tgaacatcagagttaga |
40513459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University