View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19097_high_92 (Length: 229)
Name: NF19097_high_92
Description: NF19097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19097_high_92 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 40440753 - 40440981
Alignment:
| Q |
1 |
acttacatgtgaccacacatattccctcaaaacctttattcattatatccaatcgaacttactatgcaacagattagctgaccagaaggccaatcacctt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40440753 |
acttacatgtgaccacacctattccctcaaaacctttattcattatatccaatcgaacttactatgcaacagattagctgaccagaaggccaatcacctt |
40440852 |
T |
 |
| Q |
101 |
tgcatgttttgtgatgaaccatttacacctagtcaccaactcaaacgcaaaaagtctcgattattagtgttggaattagataaggatgatgacggtgagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40440853 |
tgcatgttttgtgatgaaccatttacacctagtcaccaactcaaacgcaaaaagtctcgattattagtgttggaattagataaggatgatgacggtgagg |
40440952 |
T |
 |
| Q |
201 |
ttaatgatgaataaattgtcgtggaacat |
229 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
40440953 |
ttaatgatgaataaattgtcatggaacat |
40440981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University