View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19097_low_34 (Length: 357)
Name: NF19097_low_34
Description: NF19097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19097_low_34 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 214 - 357
Target Start/End: Complemental strand, 2453250 - 2453107
Alignment:
| Q |
214 |
tttgggtccgtcactacctcaaatgatcaaacaaccaaaccctaagaaacacaaaaaacatgatctagtaaaatggtacgatttatggctaaatcaataa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2453250 |
tttgggtccgtcactacctcaaatgatcaaacaaccaaaccctaagaaacacaaaaaacatgatctagtaaaatggtacgatttatggctaaatcaatag |
2453151 |
T |
 |
| Q |
314 |
attagtgataacttcaccatcatgaatacagaccatgcatataa |
357 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2453150 |
attagtgataacttcaccatcatgaatagagaccatgcatataa |
2453107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 10 - 125
Target Start/End: Complemental strand, 2453441 - 2453326
Alignment:
| Q |
10 |
aacaaaatgcaacttaaaatttatgctcactgctaatttattttgggaaatgaaaaattagtattaaaacatactccatcgggtcgtaattataagaatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2453441 |
aacaaaatgcaacttaaaatttatgctcactgctaaattatattgggagatgaaaaattagtattaaaacatactccatcgggtcgtaattataagaatg |
2453342 |
T |
 |
| Q |
110 |
atcattcggtcatttt |
125 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2453341 |
atcattcggtcatttt |
2453326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University