View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19097_low_38 (Length: 332)
Name: NF19097_low_38
Description: NF19097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19097_low_38 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 213 - 332
Target Start/End: Complemental strand, 31013241 - 31013122
Alignment:
| Q |
213 |
tctttcgttcgggtatgtcaatgagaccatatcagtcacatttgattataattctctacaatattaaacattgcaacacgaccgttacgattaccgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31013241 |
tctttcgttcgggtatgtcaatgagaccatatcagtcacatttgattataattctctacaatattaaacattgcaacacgaccgttacgattaccgcaaa |
31013142 |
T |
 |
| Q |
313 |
aacctactttatttgttatg |
332 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31013141 |
aacctactttatttgttatg |
31013122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 100 - 168
Target Start/End: Complemental strand, 31013309 - 31013241
Alignment:
| Q |
100 |
tcttaagaaggattttaaataaaggctcatgcacaatctaactgtcgatgaggctatatcagtcgcatt |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31013309 |
tcttaagaaggattttaaataaaggctcatgcacaatctaactgtcgatgaggctatatcagtcgcatt |
31013241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 237 - 289
Target Start/End: Complemental strand, 31002534 - 31002482
Alignment:
| Q |
237 |
gaccatatcagtcacatttgattataattctctacaatattaaacattgcaac |
289 |
Q |
| |
|
||||| |||||||||||||| || | |||||||||||||||||| |||||||| |
|
|
| T |
31002534 |
gaccacatcagtcacatttgtttgtgattctctacaatattaaaaattgcaac |
31002482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University