View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19097_low_44 (Length: 310)
Name: NF19097_low_44
Description: NF19097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19097_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 15 - 300
Target Start/End: Original strand, 11369858 - 11370143
Alignment:
| Q |
15 |
aatattatgaatcgattatttattattgactgatgcgcatctttgctcagtttaagtggctgcaatgcaagaattaatgattgtatatgagtgtttgttg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11369858 |
aatattatgaatcgattatttattattgattgatgcgcatctttgctcagtttaagtggctgcaatgcaagaattaatgattgtgtatgagtgtttgttg |
11369957 |
T |
 |
| Q |
115 |
ctgtaatgagatgtttataagttgaagttgcattttttgacgaaatttgacacattaggtgcagggattgatgtgttgttttcgaaaacgggtgtaccag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11369958 |
ctgtaatgagatgtttataagttgaagttgcattttttgacgaaatttgacacattaggtgcagggattgatgtgttgttttcgaaaacgggtgtaccag |
11370057 |
T |
 |
| Q |
215 |
taacacttgagttttgcaaattaggtgttgttttattttatatgtagctgtcgggtcagttgggcatggagtttttgtcccctatg |
300 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
11370058 |
taccacttgagttttgcaaattaggtgttgttttattttatatgtagccgtcgggtctgttgggcatggagtttttgtcctctatg |
11370143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University