View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19097_low_50 (Length: 282)
Name: NF19097_low_50
Description: NF19097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19097_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 12 - 265
Target Start/End: Complemental strand, 15116298 - 15116045
Alignment:
| Q |
12 |
atgaaaaaatgtctcaattggtgggacttgatttggtttggctttggtgcagtaattggtgcaggaatctttgtgctaactggtcaagaagctcataacc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116298 |
atgaaaaaatgtctcaattggtgggacttgatttggtttggctttggtgcagtaattggtgcaggaatctttgtgctaactggtcaagaagctcataacc |
15116199 |
T |
 |
| Q |
112 |
atgcaggagcagcaatagttttatcctatgtagcttcaggaatatcagcaatgctttctgttttttgttacacagaatttgccgttgaagttccagctgc |
211 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15116198 |
atgcaggagcagcaatagtcttatcctatgtagcttcaggaatatcagcaatgctttctgttttttgttacacagaattcgccgttgaagttccagctgc |
15116099 |
T |
 |
| Q |
212 |
aggtggttcatttgcttatctaagaattgaattaggtgactttgttgctttcat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116098 |
aggtggttcatttgcttatctaagaattgaattaggtgactttgttgctttcat |
15116045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University