View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19097_low_51 (Length: 278)
Name: NF19097_low_51
Description: NF19097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19097_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 71 - 263
Target Start/End: Complemental strand, 2765894 - 2765702
Alignment:
| Q |
71 |
tagctttgcctactgttatatagcgaggaacaatgtttgttgttggaaatatgtatgtgggacgagcatttatatatatagttagatgaggaaaaaacaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2765894 |
tagctttgcctactgttatatagcgaggaacaatgtttgttgttggaaatatgtatgtgggacgagcatttatatatatagttagatgaggaaaaaacaa |
2765795 |
T |
 |
| Q |
171 |
attaacatgaaggaaatttgtggaaggagtaaattttaaggttgttggtatgctaggcacaattgtaatatttcgtggccttcttggaaggtg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2765794 |
attaacatgaaggaaatttgtggaaggagtaaattttaaggttgttggtatgctaggcacaattgtaatatttcgtggccttcttggaaggtg |
2765702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 2765964 - 2765922
Alignment:
| Q |
1 |
gaactcgatgccatttttgctcaattttgtgaagttgtaatat |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2765964 |
gaactcgatgccatttttgctcaattttgtgaagttgtaatat |
2765922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University