View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19097_low_58 (Length: 265)
Name: NF19097_low_58
Description: NF19097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19097_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 52039090 - 52039329
Alignment:
| Q |
18 |
ctctattcttgcatgacaactccatcaatattaattccaattatttgtttccctggactcatgcataacggttccatcaaattatttatttgtcatgact |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52039090 |
ctctattcttgcatgacaactccatccatattaattccaattatttgtttccctggattcatgcataacggttccatcaaattatttatttgtcatgact |
52039189 |
T |
 |
| Q |
118 |
tattcataatcgttctttcaatttgtagtctcattctaaccatagcagctccctcattcttac--cttgcaaaacatgtacagctacaaaaccatgtact |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52039190 |
tattcataatctttctttcaatttgtagtctcattctaaccatagcagctccctcattcttacattttgcaaaacatgtacagctacaaaaccatgtact |
52039289 |
T |
 |
| Q |
216 |
cttgattccaaaagaaaaataatacacataagagcctttg |
255 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52039290 |
cttgattccaaaagaaaaataatatacataagagcctttg |
52039329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 53552772 - 53552854
Alignment:
| Q |
18 |
ctctattcttgcatgacaactccatcaatattaattccaattatttgtttccctggactcatgcataacggttccatcaaatt |
100 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||| ||||||| ||| |||||||||||||||| ||||||| |
|
|
| T |
53552772 |
ctctattcttgaatgacagctccatcaatattaattccaattatttctttcccttgacccatgcataacggttccttcaaatt |
53552854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University