View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19097_low_70 (Length: 252)

Name: NF19097_low_70
Description: NF19097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19097_low_70
NF19097_low_70
[»] chr7 (1 HSPs)
chr7 (15-231)||(40513459-40513675)


Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 40513675 - 40513459
Alignment:
15 cacagattaaaaatataccatgcaagttaagtatgcaaactttgaattcatgtgaaagagcggaggggcatgaggaattgcagaattaatatagaaaaga 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40513675 cacagattaaaaatataccatgcaagttaagtatgcaaactttgaattcatgtgaaagagcggaggggcatgaggaattgcagaattaatatagaaaaga 40513576  T
115 ttaattttttaaccttaccattacactcttatcaacaggcatatcatcccagttacgctgaacttgcaaaccacttccattgtggtgcatgttcatcatt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40513575 ttaattttttaaccttaccattacactcttatcaacaggcatatcatcccagttacgctgaacttgcaaaccacttccattgtggtgcatgttcatcatt 40513476  T
215 tgaacatcagagttaga 231  Q
    |||||||||||||||||    
40513475 tgaacatcagagttaga 40513459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University