View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19097_low_84 (Length: 245)
Name: NF19097_low_84
Description: NF19097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19097_low_84 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 148 - 199
Target Start/End: Original strand, 38331339 - 38331390
Alignment:
| Q |
148 |
ttttctttgaaagagatcatatacattttttattcaatgaatctaaagagtg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38331339 |
ttttctttgaaagagatcatatacattttttattcaatgaatctaaagagtg |
38331390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 38331193 - 38331262
Alignment:
| Q |
1 |
tatgagtataaacaactttttactttttaaatttattaaatatatggaagttagttcaaactccgaccac |
70 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
38331193 |
tatgagtataaacaactttttattttttaaatttattaaatatatttaaactagttcaaactccgaccac |
38331262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 42
Target Start/End: Original strand, 8955354 - 8955389
Alignment:
| Q |
7 |
tataaacaactttttactttttaaatttattaaata |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8955354 |
tataaacaactttttactttttaaatttattgaata |
8955389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University