View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19097_low_98 (Length: 210)
Name: NF19097_low_98
Description: NF19097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19097_low_98 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 194
Target Start/End: Complemental strand, 26278872 - 26278693
Alignment:
| Q |
15 |
agcaaaggtcgggttatgggcttcaaagccaactgtatatctgcccctttgtatcaggaaaattgttcttctaactttagaattgcattaacaccccaaa |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26278872 |
agcaaaggtcgggctatgggcttcaaagccaactgtatatctgcccctttgtatcaggaaaattgttcttctaactttagaattgcattaacaccccaaa |
26278773 |
T |
|
| Q |
115 |
attacctaattgaactcaacggcagttaactattgctcaccccaaacgacggttaattgccgcagcgttctggtttattc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26278772 |
attacctaattgaactcaacggcagttaactattgctcaccccaaacgacggttaattgccgcagcgttttggtttattc |
26278693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University