View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19098_low_3 (Length: 323)
Name: NF19098_low_3
Description: NF19098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19098_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 307
Target Start/End: Complemental strand, 36216795 - 36216506
Alignment:
| Q |
16 |
atgtggtttactgggaagtttttgacaatgtttaaaagttgcacccctatactttctcagattgacgtagttcatcagtagtgaattcatatttcctgga |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
36216795 |
atgtggtttacagggaagtttttgacaatgtttaaaagttgcatccctatactttctcagattgatgtagtttatcagtagtgaattcatatttcctgga |
36216696 |
T |
|
| Q |
116 |
cgtgagttttgactatggaatttaatttttccagacacgcactcaatcatattataccatgtcagacaaaagaattagcatacgtttggatgtacgtcgc |
215 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36216695 |
cgtgagttttgactatggaatttaa-ttttccagacacgcactaaatcttattataccatgtcagacaaaagaattaccatacgtttggatgtacgtcgc |
36216597 |
T |
|
| Q |
216 |
gatctattttctcaagtcccaacgtgttatcgacgtgaatcttcagattctaagaattcaagcttctaaataaatgtgagtttagtgcctat |
307 |
Q |
| |
|
|||||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36216596 |
gatcta-tttctcatgtcccaatgtgttatcgacgtgaatcttcagattctaagaattcaagcttctaaataaatgtgagtttggtgcctat |
36216506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University