View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_high_32 (Length: 267)
Name: NF19099_high_32
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 105 - 258
Target Start/End: Original strand, 4707498 - 4707651
Alignment:
| Q |
105 |
ctttgagtgcattcagtaaatttcttaaatcgtatgtttatgttgtcctttttgtaagtgatcttgtacaaaacttttttctgttatatatagtgtaacc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4707498 |
ctttgagtgcattcagtaaatttcttaaatcgtatgtttatgttgtcctttttgtaagtgatcttgtacaaaacttttttctgttatatatagtgtaacc |
4707597 |
T |
|
| Q |
205 |
ggtatgatttagtgccttattttgttcttcctaagtgatcttatgcagaattat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4707598 |
ggtatgatttagtgccttattttgttcttcctaagtgatcttatgcagaattat |
4707651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 84
Target Start/End: Original strand, 4707429 - 4707465
Alignment:
| Q |
48 |
ttaattccgcttttactacgacaaattcctaggttgt |
84 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4707429 |
ttaattccacttttactacgacaaattcctaggttgt |
4707465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University