View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_high_36 (Length: 255)
Name: NF19099_high_36
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_high_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 2257329 - 2257090
Alignment:
| Q |
1 |
tcaatgaaatagttagcgaacgagacgggtgtgatgctcaatcgatccttccatgctacagagaccgggaacataaactcgacatcaaatacatcggatt |
100 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
2257329 |
tcaatgaaataggtagcgaacgtgacgggtgtgatgctcaatcgatcattccatgccacagagaccgggaacataaacttgacaacaaacacatcggatt |
2257230 |
T |
|
| Q |
101 |
tgagaaaatttgattcttcgcacggttttcatccatattcacaactttcaactgttttcttctttgtcgatggagaaactatctatctcgggcattggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2257229 |
tgagaaaatttgattcttcgcacggttttcatccatatccacaactttcaactgttttcttctttgtcgatggagaaactatctatctcgggcattggtt |
2257130 |
T |
|
| Q |
201 |
tatcaattttcagatacttcgagttcttcatatccaaatt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2257129 |
tatcaattttcagatacttcgagttcttcatatccaaatt |
2257090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University