View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19099_high_39 (Length: 241)

Name: NF19099_high_39
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19099_high_39
NF19099_high_39
[»] chr2 (1 HSPs)
chr2 (19-207)||(14133435-14133623)


Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 14133623 - 14133435
Alignment:
19 ccacattgctgcaaaagcccctcatgataatacggtttccataaaatttatttggaacctacatgattatgcatgactcatgcgaatcttagataataaa 118  Q
    |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||    
14133623 ccacattgctgcaaaagcccctcaagataacacggtttccataaaatttatttggaacctagatgattatgcatgagtcatgcgaatcttaaataataaa 14133524  T
119 gtgaacagatattgtaattgcctaactaaatgagtcgagtataagaacattttaacacaataatcaaagcatcttggttgagttattaa 207  Q
    | ||| | ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||    
14133523 gagaataaatattgtaattgcctaactaaatgagtggagtataagaaccttttaacacaataatcaaagcatcttggttgagttattaa 14133435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University