View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_high_41 (Length: 238)
Name: NF19099_high_41
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 9 - 183
Target Start/End: Complemental strand, 37323131 - 37322957
Alignment:
| Q |
9 |
atgaaggtgagcaagataaacatgatagtagtaaatggtgttaggcgtagcagagccagcttgcgtgagacagagtcattaatataggaagcaaatctgc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37323131 |
atgaaggtgagcaagataaacatgatagtagtaaatggtgttaggcgtagcagagccagcttgcgtgagacagagtcattaatatgggaagcaaatctgc |
37323032 |
T |
 |
| Q |
109 |
agggagagagcgtgtgatatgctttcaatttggaaagccccattgctttgcattttcttgagaaaaagagagaga |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37323031 |
agggagagagcgtgtgatatgctttcaatttggaaagccccattgctttgcattttcttgagaaagagagagaga |
37322957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 212
Target Start/End: Complemental strand, 37322923 - 37322886
Alignment:
| Q |
175 |
agagagagaaagaatgaatgtgaatcttataggagtaa |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37322923 |
agagagagagagaatgaatgtgaatcttataggagtaa |
37322886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University