View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_high_44 (Length: 209)
Name: NF19099_high_44
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_high_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 27046628 - 27046436
Alignment:
| Q |
1 |
ctcatatgtagataaggtcacaatagcctacttctttgatgaccatgaaatagctcatgatccaagcttgaacacatacccagaggtactctttcaatca |
100 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27046628 |
ctcagatgtagataacgtcacaatagcctacttctttgatgaccatgaaatagctcatgatccaagcttgaacacatacccagaggtactctttcaatca |
27046529 |
T |
 |
| Q |
101 |
taaaggtctcctacataattagagtcataccagcctagcagttctccttcttttcccttttcatttatcacactaaaactcagggtgcccttc |
193 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27046528 |
taaaaatctcctacataattagagtcataccagcctagcagttctccttcttttcccttttcatttatcacactaaaactcagggtgcccttc |
27046436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 11 - 95
Target Start/End: Original strand, 10781223 - 10781307
Alignment:
| Q |
11 |
gataaggtcacaatagcctacttctttgatgaccatgaaatagctcatgatccaagcttgaacacatacccagaggtactctttc |
95 |
Q |
| |
|
|||||||| ||||||| | ||||||||||||||| || | ||||| | ||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
10781223 |
gataaggtaacaataggttgcttctttgatgaccaagacacagctccagttcccagcttgaacacataccctgaggtactctttc |
10781307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University