View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_high_8 (Length: 517)
Name: NF19099_high_8
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 18 - 462
Target Start/End: Original strand, 15935689 - 15936133
Alignment:
| Q |
18 |
agtaattcgatttgtacgagggaaaaggaaagatagaacggctcccaaaggagcgaacatggtttgtaactccgcttcgaggatgcgatctgcttcgcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15935689 |
agtaattcgatttgtacgagggaaaaggaaagatagaacggctcccaaaggagcgaacatggtttgtaactccgcttcgaggatgcgatctgcttcgcct |
15935788 |
T |
|
| Q |
118 |
tcgttgaggttagaaagctttttgccgaggagctcgtataattcatcgtcggggagacgagatatcacaaatttggggaggtaagggaccttgtttgcca |
217 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
15935789 |
tcggggaggttagaaagctttttgccgaggagctcgtataattcatcgtcggagagacgagatattacaaatttggggaggtaagagaccttgtttgcca |
15935888 |
T |
|
| Q |
218 |
atctgatggccacttgccgaatgagtgggtcgaacttttcgtccacgacgttgccggagccggaagccatcctgtatctgtttgtgtttgtttagcaggc |
317 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15935889 |
atctgatggccacttgccgaatgagcgggtcgaacttttcgtccacgacgttgccggagccggaagccatcctgtatctgtttgtgtttgtttagcaggc |
15935988 |
T |
|
| Q |
318 |
aggttaggttaggttacgtgatatttgagtatgagtatttaaccctactgttttggatataacaaacnnnnnnnccctaattacgtgaagccgaacctaa |
417 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15935989 |
aggttaggttaagttacgtgatattttagtatgagtatttaaccctactgttttggatataacaaacaaaaaaaccctaattacgtgaagccgaacctaa |
15936088 |
T |
|
| Q |
418 |
cacctcacccttaaaagcagccaatcaaatattttcaataattaa |
462 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15936089 |
cacctcacccttaaaagcagccaatcaaatattttcaataattaa |
15936133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University