View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_low_29 (Length: 285)
Name: NF19099_low_29
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 39768516 - 39768373
Alignment:
| Q |
1 |
acccggccacagtatctgttcaacaagcccttcacgggctttcgtatgctgtttatgggaaacgtgatgtgagacgtctaatgtttgaggtttttgatgt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39768516 |
acccggccacggtatctgttcaacaagcccttcacgggctttcgtatgctgtttatgggaaacgtgatgtgagacgtctaatgtttgaggtttttgatgt |
39768417 |
T |
 |
| Q |
101 |
tgagcaaattcagcctaaaagaaatatatatgtaaagagacagt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39768416 |
tgagcaaattcagcctaaaagaaatatatatgtaaagagacagt |
39768373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 263
Target Start/End: Complemental strand, 39768293 - 39768264
Alignment:
| Q |
234 |
ggtttaggttatcaacttaatggtcaggta |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39768293 |
ggtttaggttatcaacttaatggtcaggta |
39768264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 50 - 119
Target Start/End: Original strand, 5689492 - 5689561
Alignment:
| Q |
50 |
tgtttatgggaaacgtgatgtgagacgtctaatgtttgaggtttttgatgttgagcaaattcagcctaaa |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
5689492 |
tgtttatgggaaacgcgatgtgagacgtctgatgtttgagtattttgactttgagcagattcagcctaaa |
5689561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University