View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_low_31 (Length: 275)
Name: NF19099_low_31
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 266
Target Start/End: Complemental strand, 4381562 - 4381316
Alignment:
| Q |
19 |
gtaacttgctttacaccttgtctttatcaccattctctttaaactgaaatgtacgtaatttatttgannnnnnnnnnnacatgcaataggttcgaacatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4381562 |
gtaacttgctttacaccttgtctttatcaccattctctttaaactgaaatgtacgtaatttatttgatttttttttt-acatgcaataggttcgaacatt |
4381464 |
T |
 |
| Q |
119 |
gtggggttttaaattgatccaagtagaattctatcaatgtgatgttggataaacggaagcaacttgttaattgtcccataaagaggaggacttgagaaac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
4381463 |
gtggggttttaaattgatccaagtagaattctatcaatgtgatgttggataaacggaagcaacttgttacttgtcccataaagaggaggacttgagagac |
4381364 |
T |
 |
| Q |
219 |
ccaaataaaaattctagggtagtctcataaacgatttaaaatgaaaat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4381363 |
ccaaataaaaattctagggtagtctcataaacgatttaaaatgaaaat |
4381316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University