View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_low_35 (Length: 263)
Name: NF19099_low_35
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_low_35 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 58 - 263
Target Start/End: Complemental strand, 14879394 - 14879189
Alignment:
| Q |
58 |
gtttgtggttttatagttttgcacaatggtcattggtacaatcgtcaatgaattccttcttgttttctcagatgtttatttgaacaatttgttgactaat |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
14879394 |
gtttgtggttttatagttttgcacaatggtcattggtacaatcgtcaatgaattccttcttgttttctcagatgtttgtttgaacaagttgttgactaat |
14879295 |
T |
 |
| Q |
158 |
ctttgaaccctttgagaaatattgtaattctagctagatatatatatttctttgccacttgtgttttcagatcataatttggaaaattcttaacacttgt |
257 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14879294 |
ctttgaaccctttgagaaatgttgtaattctagaaagatatgtagatttctttgccacttgtgttttcagatcataatttggaaaattcttaacacttgt |
14879195 |
T |
 |
| Q |
258 |
atgtct |
263 |
Q |
| |
|
|||||| |
|
|
| T |
14879194 |
atgtct |
14879189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University