View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_low_39 (Length: 246)
Name: NF19099_low_39
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 5 - 231
Target Start/End: Complemental strand, 4289549 - 4289323
Alignment:
| Q |
5 |
cgtgaaggttccacttgcaatcttcaattccatgctcatactcatccttagatattctgactcgaaccgtgtcactcataataatcttggtaggtagctg |
104 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||||| | |||||||| ||||||| |||||||| || | |||||||||| |
|
|
| T |
4289549 |
cgtgaaggttccgcttgcaatcttcaattccatgctcatactcatcctgagatatcttaactcgaactgtgtcacccataataacctcgataggtagctg |
4289450 |
T |
|
| Q |
105 |
agaaagttaagtgtcatcggaatttgcaagaacctgaacgaaggttttccaagttttcggcgactgtgttgtcgtcgagtccatggaagaaagaaacggc |
204 |
Q |
| |
|
| |||||| ||||||| ||||||| |||||||||| | |||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4289449 |
ataaagttgagtgtcaccggaattggcaagaacctaagcgaaggttttcccagtttctggcgactgtgttgtcgtcgagtccatggaagcaagaaacggc |
4289350 |
T |
|
| Q |
205 |
catggacaaaccatgttgcagagaaac |
231 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
4289349 |
catggacaaaccatgttgcagaaaaac |
4289323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University