View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_low_40 (Length: 241)
Name: NF19099_low_40
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 14133623 - 14133435
Alignment:
| Q |
19 |
ccacattgctgcaaaagcccctcatgataatacggtttccataaaatttatttggaacctacatgattatgcatgactcatgcgaatcttagataataaa |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
14133623 |
ccacattgctgcaaaagcccctcaagataacacggtttccataaaatttatttggaacctagatgattatgcatgagtcatgcgaatcttaaataataaa |
14133524 |
T |
 |
| Q |
119 |
gtgaacagatattgtaattgcctaactaaatgagtcgagtataagaacattttaacacaataatcaaagcatcttggttgagttattaa |
207 |
Q |
| |
|
| ||| | ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14133523 |
gagaataaatattgtaattgcctaactaaatgagtggagtataagaaccttttaacacaataatcaaagcatcttggttgagttattaa |
14133435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University