View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_low_41 (Length: 239)
Name: NF19099_low_41
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 45515080 - 45515310
Alignment:
| Q |
1 |
tagtactccggttgattggcctagtcaatttgtcacggaagtagtgaaaggaacagaacttgagtataccaaaatattggagcttgtggtcaacatggac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45515080 |
tagtactccggttgattggcctagtcaatttgtcacggaagtagtgaaaggaacagaacttgagtataccaaaatattggagcttgtggtcaacatggac |
45515179 |
T |
|
| Q |
101 |
ttgtcacaaaacaatttggttggattcattccaaatgaaa---------tcacagggctgcatggcttgaacttgtcaagaaatcatttgaaaggagaga |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45515180 |
ttgtcacaaaacaatttggttggattcattccaaatgaaatcacatggctcacaggactgcatggcttgaacttgtcaagaaatcatttgaaaggagaga |
45515279 |
T |
|
| Q |
192 |
ttcctcaattgatgggacgcatgaaatcact |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45515280 |
ttcctcaattgatgggacgcatgaaatcact |
45515310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University